LukeHagman LukeHagman
  • 03-11-2021
  • Mathematics
contestada

What are the x and y intercepts for the graph of 2x-5y=10

Respuesta :

syahbanazacki
syahbanazacki syahbanazacki
  • 04-11-2021

Step-by-step explanation:

x intercept, y = 0

2x - 5y = 10

2x = 10

x = 10/2 = 5

x intercept = (5 , 0)

y intercept, x = 0

2x - 5y = 10

-5y = 10

y = 10/-5 = -2

y intercept = (0 , -2)

Answer Link

Otras preguntas

How do I use a codon wheel to solve this sequence of DNA? AGTACCCGTTAATTAGTTGCCG
Which Native American culture would have spent the MOST time hunting buffalo
How were U.S. policies used to justify Manifest Destiny?
Please help ASAP! I will mark BRAINLIEST! Please answer CORRECTLY! No guessing!
What must be present for scientists to detect black holes?.a cloud of dust. a gamma ray burst. the loss of a star.the force of gravity
Uranium-235 has 92 protons. How many neutrons does it have?
HELP RIGHT NOW FOR MATH ADVANCED
find y...............................................
Write the repeating decimal as a fraction
very simple why is it that math is the only subject that people seem to care about 50 points