Iwritewithpencils Iwritewithpencils

14-05-2020
Biology

contestada

How do I use a codon wheel to solve this sequence of DNA?

AGTACCCGTTAATTAGTTGCCG

Respuesta :

andyk38105 andyk38105

14-05-2020

Answer:

Group the sequence into sets of 3, triplets we formally call codons. These codons will be part of mRNA. Then match those codons using the wheel with their corresponding amino acids!

Answer Link

Otras preguntas

A(n) ________ specifically names the steps that the experimenter must use to control or measure the variables in the experiment.

y is less than or equal to 3/2x

Utricionista aquÃ tengo los resultados de los anÃ¡lisis que (nosotros) (1) (hacer) la semana pasada. su nivel de colesterol (2) (aumentar). paciente pero docto

Sadi Carnot came up with a hypothetical heat engine that had the maximum possible efficiency. What discovery did Carnot make that helped him recognize how to cr

Which best matches the description with the genetic material? Nucleotides form a helical structure that is called a gene. Chromosomes are located in the cytopla

elements in the same group (family) appeared to have the same what? A) valence. B) melting point. C) isotopic ratio. D) number of neutrons.

what 3 numbers that you can X to get 120

Evaluate the line integral ∫cf⋅dr∫cf⋅dr, where f(x,y,z)=−5xi+yj+zkf(x,y,z)=−5xi+yj+zk and c is given by the vector function r(t)=⟨sint,cost,t⟩, 0≤t≤3π/2.

Who was the secretary of the Philadelphia Convention

In at least one hundred words, explain why the story of Shahrazad and the evil king in The 1001 Nights is considered a "frame story."