lillajjberry lillajjberry

04-03-2021
Biology

contestada

What are the 3 most important parts of a seed

Respuesta :

jfjsjskjndjsjs jfjsjskjndjsjs

04-03-2021

Embryo, endosperm, and seed coat

Answer Link

erickvilmene315 erickvilmene315

04-03-2021

Answer:

the 3 primary part of a seed are the embryo, endosperm, and seed coat.

expaination:The embryo is the young multicellular organism before it emerges from the seed.

Answer Link

Otras preguntas

AC = Round your answer to the nearest hundredth. 40°

Which is NOT considered a greenhouse gas? a)carbon dioxide (CO2) b)ozone (O3) c)helium (He) d)nitrous oxide (NO2) e)methane (CH4)

Solve for x. Round to the nearest tenth

Circle with radius 5 units and center P (-4, -10)

6(2+3K) + 2(5 + 36 ) =

E=mc (the 'c' is squared btw.. it has a little 2 at upper right conner) To solve for " m " in the formula shown above, you should: Select one: a. A.) Divide bo

You should meet with your academic adviser at least once a __________. Group of answer choices

HELP:( Why did some delegates to the Convention fear creating a Central Government? A)they feared a strong central government would abuse its power. B)they fear

Is the below sequence DNA or RNA? How do you know? GTTTACAGGCGGCGCAATATCTGATCG

Repaso: Di si la siguiente oración es cierta o falsa. El vocabulario y la fonética cambian según las varias regiones del mundo hispanohablante. True False