sophiafriend34 sophiafriend34

15-05-2020
Biology

contestada

Is the below sequence DNA or RNA? How do you know?
GTTTACAGGCGGCGCAATATCTGATCG

Respuesta :

queenb74 queenb74

15-05-2020

The answer is DNA I know because I know

Answer Link

savitar0291 savitar0291

15-05-2020

Answer: DNA

Explanation: DNA has Thymine, Guanine, Cytosine, and Adenine.

RNA has all of those except for adenine which is replaced with Uracil.

Answer Link

Otras preguntas

What does “ ok it’s smoove “ mean?

a) Work out 41/7 + 1 1/2

Maggie is making a necklace using string and identical beads.The 12 beads fill 4 inches of the string.How many beads are in 1 inch of string

HELP PLEASE WILL GIVE BRAINLISET

write a statement that is your opinion about the paragraph. As a result of the limited success of the St. Thomas colony, Denmark decided to expand. In 1717, a

The code of hammurabi of _____ was written in 1760 bc.

. Which is not a property of magnets? AThey point north when allowed to swing freely on a string. B They attract or repel other magnets. C Their force of attra

(iii) ............ characters can be stored in memo field. (a) 50 (b) 64000 (c) 255 (d) 200

. SCULPTURE An artist creates two metal sculptures in the shape of regular octagons. A side of the larger sculpture is 3.5 times longer than a side of the small

f(x) = x^1/2 is continuous for all x but not differentiable at x=0. is it True or False?