winterrehnborgp3fdk6 winterrehnborgp3fdk6

04-04-2018
English

contestada

Crystal moment by Robert Tristram coffin is written with which stanza form?
A. Rhyming couplets
B. Tercets
C. Quatrains
D. Non of the above

Respuesta :

04-04-2018

Hi there!

Thank you for posting your question here at brainly. I hope the answer will help you. Feel free to ask more questions here.

Crystal moment by Robert Tristram coffin is written with the stanza for Tercets

Hence, the answer to your question is B = Tercets

Sincerely,

Dus4nR :)

Answer Link

Smosley78 Smosley78

04-04-2018

The correct answer is B. Tercets

Answer Link

Otras preguntas

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

this has me so confused on how you get the answers

Joan is 5 years older than ellen, and 3 years ago the sum of their ages was 17 years. in how many years will joan be 21 years old?

Analyze how the stipulations of the treaty of versailles that ended world war i, along with the great depression of the 1930s, contributed to the outbreak of wo

Solve for x in terms of the other matrices and/or their inverses. x=b+ax

Why did new technology revolutionize communications

The length of a rectangle is three times its width. If the perimeter of the rectangle is 40ft find it’s area

A mudflow consists of debris with a large amount of

According to engels, what purpose did government serve? a. to organize production c. to create new jobs b. to revolt against workers d. to pass laws ending oppr

It takes 10 workers 24 hours to do a job. Fill in the chart.