rizzie rizzie
  • 03-02-2016
  • History
contestada

use sabbath,kosher synagogue to describe traditional Jewish practices

Respuesta :

Аноним Аноним
  • 04-02-2016
Sabbath is a traditional thing that jews do. Sunset Friday and sunset Saturday. They are only kosher. Only certain meats blessed by the rabbi, no pork.
Answer Link

Otras preguntas

Please help solve, thanks in advance!
define concentric circles
How did the mountains in Greece contribute to the rise of city-states?
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
What is the surface area of the prism? A. 144 in2 B. 420 in2 C. 288 in2 D. 140 in2 I really don't know where to post a link to the prism pic
what was paul revere failures
why is the square root of a perfect square always rational
The area of the base of a prism is 50 mm2. The perimeter of the base is 30 mm. The height of the prism is 7 mm. What is the surface area of the prism?
Dalia has just enough money to buy either 6 pears and 20 oranges or 12 oranges and 11 pears. A pear costs $ 0.80. How much does an Orange cost ?
Help PleaSE:) ->Grammar Which sentence has a pronoun with an unclear, missing, or confusing antecedent? A. The lifeguards sat in tall chairs; they could