coolbro172 coolbro172

02-03-2018
Mathematics

contestada

calculate the volume of each of the following cubes whose side length is given. Show all your working.

calculate the volume of each of the following cubes whose side length is given Show all your working class=

Respuesta :

lilijemkins lilijemkins

02-03-2018

11cm x 11cm x 11cm = 1331cm cubed

Answer Link

Otras preguntas

all other things being equal,the size of a population will decrease if

What’s the answer to #12? and why

30.0 ml of an hf solution were titrated with 22.15 ml of a 0.122 m koh solution to reach the equivalence point. what is the molarity of the hf solution?

Write a review of your favorite TV programme.Include the name and type of programme, a description of the programme and why you like it.

For which of the following materials is necessary to stop a beta particle? A. Three feet of concrete B. Three inches of lead C. Thin pieces of wood D. Single s

N general, emerging adulthood is a time during which a person functions physically and psychologically at an optimal level.

PLEASE HELP!!!!!!!!!!!!!!! Mongol conquests ranged from East Asia to Eastern Europe during the thirteenth and fourteenth centuries. This relatively short period

a school cafeteria makes 4 diffrent salads during the week but serves only 2 salads each day on a roating basis. salads: chicken,fruit,pasta,tuna. a student ran

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

Need help ASAP !!!!!!!