carithegoat
carithegoat carithegoat
  • 01-12-2017
  • History
contestada

how did ideas from the renaissance lead to the scientific revolution

Respuesta :

lizardking24516
lizardking24516 lizardking24516
  • 04-12-2017
The Renaissance caused a humanistic viewpoint instead of a supernatural one. It caused skepticism about religion. The Renaissance and the invention of the printing press caused the large literate middle class to read the bible themselves and come to their understanding. 

Hope this helps   :D 
Answer Link

Otras preguntas

what is the position of 9 in the number 932,805? A. The ten-thousands place B. The hundred-thousands place C. The hundreds place D. The ones place
Explain who or what "Año Viejo" is and its significance.
How did the mountains in Greece contribute to the rise of city-states?
What kind of problems did increased urbanization cause? During time of industrial revolution
Why was wilson not able to finish his speaking tour
I want to work with LDAP. what is LDAP?
An archer’s arrow follows a parabolic path. The height of the arrow f(x) is given by f(x) = -16x^2 + 200x + 4, in feet. Find the maximum height of the arrow.
lya took one hour to drive from his apartment to Philips Arena and back. The return drive took 8 minutes less than the trip to the arena. If x represents the ti
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
a tabletop in the shape a trapezoid has an area of 6550 square centimeters its longer base measures 115 centimeters and the shorter base is 85 centimeters what