catdarkchocolaoyi1uv catdarkchocolaoyi1uv

01-11-2017
Social Studies

contestada

through (9,5), perpendicular to -4x-7y=-71

Respuesta :

Аноним Аноним

01-11-2017

y=-4/7x + 71/7 the question wasnt very clear but i put it in y=mx+b

Answer Link

Otras preguntas

In a probability experiment, Craig rolled a six-sided die 55 times. The die landed on a number greater than three 31 times. What is the ratio of rolls greater t

Express the perimeter of the triangle as a polynomial. 8x+2 5x-4 9x+3

5. On average, how many years earlier do smokers die than nonsmokers? (Points : 1) 5 to 6 10 to 11 13 to 14 19 to 20

what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5

This natural landmark was created by the natural forces of erosion. What is its correct name and location?

There are 23 tables in the library. Each table has 4 chairs. Third grader fill the chairs at 3 tables. Fourth graders fill the chairs at 6 tables. The rest of t

the bombing of Hiroshima and Nagasaki resulted in

Which powerful religious group often tried to close the theaters in Shakespeare's time? A. the Puritans B. the King's Men C. the Pilgrims D. the Jacobites

Which is the best description of civil liberties? A. natural rights B. privileges C. rights guaranteed by law D. democratic goals E. trial procedures

In a probability experiment, Craig rolled a six-sided die 55 times. The die landed on a number greater than three 31 times. What is the ratio of rolls greater t