jordysonmomyholyshet
jordysonmomyholyshet jordysonmomyholyshet
  • 03-10-2017
  • Mathematics
contestada

Which number can each term of the equation be multiplied by to eliminate the fractions before solving? -3/4m - 1/2 = 2 +1/4 m

Respuesta :

Аноним Аноним
  • 03-10-2017
That would be the LCD of 2 and 4m

Its 4m 
Answer Link

Otras preguntas

When 40 is added to the number of miles Karen ran last week, the result is the same as adding 10 to 4 times the number of miles she ran last week. How many mile
What Role Does the Sun Play in Producing Winds And Ocean Currents
the volume of a rectangle prism with square bases is 5880 cubic inches. it has a height of 30 inches. find the side length of the square base.
How did the mountains in Greece contribute to the rise of city-states?
how many 1 1/2 centimeter cubes can fit into a rectangular prism that has a length of 12 centimeters , a width of 6 centimeters and a height of 9 centimeters
Gina rented shoes, bowled 3 games, and bought 1 order of nachos. she used a coupon for 1/2 off the price of her bowling games. What was Ginas total cost before
Susan ........ (Run) to school because she was late.
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Which theater is considered Shakespeare's theater? A. The Swan B. The Globe C. The Rose D. The Stage
In which sentence does the prepositional phrase act as an adverb? A. Last evening, Anne suffered from a headache. B. The door to the attic was left open. C. Mr