codyj110792ox8abw codyj110792ox8abw
  • 03-10-2017
  • Mathematics
contestada

82.53 is 315% of what number

Respuesta :

KtIsSatan
KtIsSatan KtIsSatan
  • 03-10-2017
All you have to do is divide 82.53 by 3.15 to get 26.2
Answer Link

Otras preguntas

A person is selected at random from a crowd. You want to find the probability of the event that this person is a female and the probability of the event that th
Phillip advised his clients they needed to paint their master bedroom before showing the property. the walls of this room were 11' high. the wall lengths were 1
I'm not sure how to do this I was not there that day they taught this and idk what some are and it was yesterday so..
In a fruit punch, Sally mixed 3 3/4 cups of grape juice, 2 1/2 cups of pineapple juice and 6 2/3 of ginger ale. How many cups of punch did she have?
How did president franklin roosevelt respond to adolf hitler's attack on the soviet union in june 1941?
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
Which of these describes an endothermic process? When lithium is placed in water, the temperature of the container increases. The combustion of kerosene re
When Anne begins to think about a boy friend, someone in turn drives her to think about Peter van Daan. Who? Peter Wessel Miep de Jong Harry Goldberg
crystal lattice definition
If the measures of two opposite angles of a parallelogram are represented by 3x+40 and x+50 what is the measure of each angle of the parallelogram