justinbello12533165 justinbello12533165
  • 03-08-2017
  • Mathematics
contestada

A water cooler holds 1,284 ounces of water. How many more 6 ounce glasses than 12-ounce glasses can be filled from the cooler

Respuesta :

sajnishah2005
sajnishah2005 sajnishah2005
  • 03-08-2017
Answer:
- The water cooler can hold 214 of the 6-oz glasses because 1284 / 6 = 214

- The water cooler can hold 107 of the 12-oz glasses because 1284 / 12 = 107

- Because it is asking how many more glasses, you would do 214 - 107 = 107.

- You could also say that the water cooler can hold twice as many 6-oz glasses than 12-oz glasses.

Hope that helps! :)
Answer Link
yanad406 yanad406
  • 03-08-2017
twice as much 6 oz cups!!!!!
Answer Link

Otras preguntas

what is 15/24 in simplest form
How many times does four go into 153 ? What Is the remainder ?
Ms Graves gave her class 12 minutes to read. Carrie read 5/1/2 pages in that time. At what rate, in the pages per hour, did Carrie read?
When 40 is added to the number of miles Karen ran last week, the result is the same as adding 10 to 4 times the number of miles she ran last week. How many mile
Express the perimeter of the triangle as a polynomial. 8x+2 5x-4 9x+3
What are the factors of 6x + 24?
what are 2 points on the graph for 6x-5y=25
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Why is California warm and moderately humid but Nevada is hot and dry? A. The two states are at different latitudes. B. As air moves west over California's mo
Sue stacked one box onto another. The bottom box had the height of 2 1/3 feet and the top box had the height of 3 2/3 feet. How tall were the stacked boxes?