IvblanyDarkaw IvblanyDarkaw
  • 04-06-2017
  • History
contestada

Why did the u.s. congress reject american involvement in the league of nations?

Respuesta :

Puggy1215
Puggy1215 Puggy1215
  • 06-06-2017
Because they didn't want to be tied down by any rules. In world war one.
Answer Link

Otras preguntas

5. On average, how many years earlier do smokers die than nonsmokers? (Points : 1) 5 to 6 10 to 11 13 to 14 19 to 20
4.2meters= how many centimeter
Which of the following is NOT a form of formal debate? A. an argument B. policy debate C. parliamentary debate D. Lincoln-Douglass debate
which point is in the solution set to the system of inequalities: y>2x-1 and y<1/2x+5
Aiden wrote a riddle: Five less than 1/5 times a number is same as the sum of the number and 1/3. Find the number
How has water influenced the development of civilization in Africa
Which powerful religious group often tried to close the theaters in Shakespeare's time? A. the Puritans B. the King's Men C. the Pilgrims D. the Jacobites
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Angie takes a random sample of 100 students in her school and finds that 58% of the sample prefers art over music. There are 1,200 students in the school. Based
What is the adjective in the following sentence? The yellow sun hung brightly in the sky. a. Brightly b. Sun c. Yellow d. Hung