gonzalmonilol3x gonzalmonilol3x

01-05-2017
History

contestada

What were some of the demands of latino groups in the 1960s and 1970s?

Respuesta :

sprinklebottle sprinklebottle

01-05-2017

1. Better wages and working conditions
2. Recognition of their culture in school
3. Greater political representation

Answer Link

Otras preguntas

Jeremy was asked to describe the impact of humans on the carbon cycle. He answered: "When people drive cars they add more carbon dioxide to the atmosphere." Jer

What decade was considered the “prime era" for television?

I need helpppp anybody pleaseeeee

8 What are three advantages of corporations?

Michael is the youngest person in the office. Judy is the oldest person in the office. The age difference between Michael and Judy is more than 35. If Michael i

PLZ HELP Translate this segment of RNA into the corresponding amino acids. mRNA: AAAAUUCGGCAUGCCGUUAAUGCCCUCGGGGUGA *Remember to begin with the Start Codon "AU

evaluate function expression 5xf(1) + 5xg(9)

1 webbed feet 2wing structure 3beaks 4 eye color

Question 2 of 10 Fill in the blank with the correct form of aller. Tu peux apporter des chips et du coca si tu dans la cuisine? O A. allez B. va O C. vas D. as

Little Rock nine:What caused the Little Rock,Arkansas school board to desegregate