keriprice4844 keriprice4844
  • 04-06-2022
  • Biology
contestada

What factors can limit growth?

competition
amount of sunlight or water
r-selected species
geographic borders

Respuesta :

cs2115diatm cs2115diatm
  • 04-06-2022

The answer is

Amount of sunlight or water.

As growth depends on sunlight and water so it is important to grow a plant in proper sunlight and giving plants regular water is also important.

learn more things about what factors growth

https://brainly.com/question/3944507

Answer Link

Otras preguntas

as an allied health worker the single most important thing you can do to prevent the spread of disease is A. take antibiotics B. use antibacterial gel C. wash
_______ is the largest continental biome. It experiences long, cold winters; short, mild summers; and low precipitation. It is characterized by coniferous fore
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Please answer theses division problems!! 9 divided by 3/7
the reproductive system of a male mammal provides
CAN ANYONE PLEASE HELP WITH MATH? The rectangle has an area of 4(x+3) square units. A- If the dimensions of the rectangle are doubled, what is the area of the n
Which sentence does not contain any errors in comma usage? A. If you ever visit New Haven, Connecticut, be sure to eat at Sally's Pizza. B. The original Londo
what rule does static electricity follow
What statement best describes a republic?
Which is an example of a structural adaptation of a plant? A. plant moving toward light to increase photosynthesis B. roots responding to gravity to get to wa