hithem15 hithem15
  • 02-05-2022
  • English
contestada

What is the persona's tone in the poem, "Little Boy Crying" by Mervyn Morris?

Respuesta :

g0s33kh3lp
g0s33kh3lp g0s33kh3lp
  • 02-05-2022

Guilt, ashamed, and hurtful. The father feels heavy guilt of hitting his son

Answer Link

Otras preguntas

What kind of problems did increased urbanization cause? During time of industrial revolution
Susan ........ (Run) to school because she was late.
what was NOT a primary goal of marriage in a feudal system at the noble level? A. Exchange of land and goods B. love and companionship C. Political arrangement
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Complete the sentences with seem, look or sound and use like or as if when necessary. 1) Quick! Emma's an the phone. She... she's calling from a long way away.
what is the position of 9 in the number 932,805? A. The ten-thousands place B. The hundred-thousands place C. The hundreds place D. The ones place
Which is the best description of civil liberties? A. natural rights B. privileges C. rights guaranteed by law D. democratic goals E. trial procedures
the volume of a rectangle prism with square bases is 5880 cubic inches. it has a height of 30 inches. find the side length of the square base.
What is the sum of 6/10 plus 7/12
What would be the most likely effect of one company buying a competitor?