wequasiacolbert13 wequasiacolbert13
  • 02-09-2021
  • Mathematics
contestada

The manager of a movie theater wants to know what types of movies his customers prefer to watch. Which sample would most likely provide the most accurate data?

Respuesta :

Brenatdrap Brenatdrap
  • 09-09-2021

Answer: a random group of 30 people at a mall

Step-by-step explanation:

Got it from edgenuiy

Answer Link

Otras preguntas

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
Which English reformer called for change in the church during the 1300's
what does the liver do in the excretory system
epistrophe literary definition
_____design in construction engineering may show that you need to excavate at the construction site before you can buildA. TopographicalB. GeographicalC. Geol
Which hormone is essential to our ability to maintain our fluid levels?
zach has 8 stores that he manages 6 of those stores are hiring what fraction of his stores are hiring?
What happens when energy is changed from one form to another? a. a physical change to a substance occurs. b. all of the energy can be accounted for. c. all of t
Explain the significance of the phoenix. what, according to granger, makes humans different from the phoenix?
Why is the epa considered to be one of the most powerful bureaucracies?