RhiRhi1230 RhiRhi1230

04-05-2021
Mathematics

contestada

work out the size angle of x. Give reasons for your answer

work out the size angle of x Give reasons for your answer class=

Respuesta :

isabellakoster isabellakoster

04-05-2021

AD and EH are parallel
the sum of 105° and x should be 180° since ABF and EFG angles are equal
180°=105°+x
180°-105°=x
75°=x

Answer Link

Otras preguntas

PLEASE!!!!!!!!!! HELP NEEDED QUICKA state offers two lottery games, WinOne and PlayBall. Both games cost $2 per ticket. -In WinOne, the player picks a single

Between 1920 and 1930, almost a million african american's left the south for the "promised land" up north during the

Who was the u.s. general fired during the korean war for trying to create another world war with china?

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

If abcd is a trapezoid with bases ab and dc. if ab=20, bc = 30, cd = 48, and ad =26, find the height of the trapezoid

this is a class called foundation seminar music and math

Explain the translation process that results in production of a polypeptide

A federal program that guarantees benefits to qualified recipients is a(n) ________ program

Please help ASAP!!!!!!!!!!!!!

distillation definition chemistry