peypeyjorg peypeyjorg

02-04-2021
Mathematics

contestada

Help with 30 please I forget what supplementary and complementary mean

Help with 30 please I forget what supplementary and complementary mean class=

Respuesta :

sunabariii sunabariii

02-04-2021

Answer:

a. ∠AMB, ∠BMC

b. ∠BMC, ∠CMD

Step-by-step explanation:

supplementary=angles add up to 180°

Complementary=angles add up to 90°

Answer Link

Otras preguntas

While the theme of "Ode on a Grecian Urn" focuses on how art is eternal, the theme of "Ozymandias" focuses on how a.royalty is superior. b.nature endures. c.thi

who invented the theory of relativity

A right triangle height of 10cm and a hypotenuse of 26cm what is the b

How do you find the length of the hypetnyuse if you have one angle and opposite side?

Frozen water (ice) has less density than liquid water. How does this property of water affect life on Earth?

Which of the following is true about a writer’s diction? a.When the writer uses sophisticated vocabulary, the diction is informal. b.When the writer uses comple

Dante has a vegetable garden. He places several earthworms in the garden’s soil. Which statement explains the most likely reason Dante puts worms in his garde

You develop an app to help students complete their homework. To earn money, you sell advertising space on the app’s main screen. An advertiser pays you $25 per

What is the solution of the system of equations? y = –2x + 8 y = x – 4

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat