gouranshchauhan80 gouranshchauhan80

03-03-2021
Mathematics

contestada

what is the GCF of 3x ^2 −12x

Respuesta :

rapatel9 rapatel9

03-03-2021

Answer:

3x

Step-by-step explanation: The GCF is the greatest number you can use to factor that equations and the greatest number is 3x.

Answer Link

Otras preguntas

A school bus has 22 rows of seats, and 4 students can be seated in each row. students have filled 19 rows of seats, abd 1/2 of the remaining seats. how many sea

Embryological evidence suggests that the echinoderms are closely related to the ______________. arachnids annelids arthropods chordates

How did the triple alliance and the triple entente change during the war?

Please help ASAP!!!! 100 points!

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

Joe has always believed that he is lousy at athletics. when he tried to play soccer, he was sure he would not be good at it, and indeed, he was not very adept.

Will bought a package of 24 juice bottles for $7.44. Which equation relates the cost, c, of a package of juice bottles to the number of bottles, b, in the packa

Find the least common multiple of the pair of polynomials. 2y^2-32 and y+4

N the world's lowest-income nations, two in ten children born die by the age of

The roman cubitus is an ancient unit of measure equivalent to 0.554m . Convert 2.22/m height of basketball forward to cubiti