lunaablan
lunaablan lunaablan
  • 02-03-2021
  • Mathematics
contestada

2x + 3y + 6 > 0????????​

Respuesta :

ashlynlopez5 ashlynlopez5
  • 02-03-2021
what are u solving for
Answer Link

Otras preguntas

in the quadrant you start at (2,6) and move 5 units right what point will end up on?
There are not kids that share their feelings with social media or parents or friends or school counselors.
Please help utilize helpful worker safety and health resources summary
Read this sentence. The wild horse is docile, allowing people to pet it all over. The meaning of docile can be determined by the ( synonym) , (antonym) or ( esp
can someone do a paragraph on W.E.B. Du Bois i had 2 people answer last time one said "Spiders eat flies" and the other one just took a screensho of sum random
Which statement corrects a misconception about Deaf communication? (4 points) Many deaf people use only oral speech. Most deaf people prefer to use lipreading.
PLZ HELP Translate this segment of RNA into the corresponding amino acids. mRNA: AAAAUUCGGCAUGCCGUUAAUGCCCUCGGGGUGA *Remember to begin with the Start Codon "AU
I need help please solve, if you can solve you are the best. \-x+sqrt1−x 2 \-=sqrt2(2x 2 −1).
How were the border states different from the other states that stayed in the Union?
helpp with all three !! will give brainliest