04-01-2021
Geography

contestada

explain three reasons for importance of studying geography

Respuesta :

04-01-2021

Answer:

because if you didn't study geography 1. you can't apply for certain careers 2. you would be able to travel 3. you wouldn't understand the history of your ancestors or the origin of the place you're currently living in.

Answer Link

Otras preguntas

Write a slope-intercept equation for a line passing through the point (4, -3) that is parallel to the line 4x + 5y = 7. Then write a second equation for a line

calculate the molar mass COSO4: _______g/mole

Which sentence has proper subject-verb agreement?(1 point) A.) Missouri and Illinois are states along the Mississippi River. B.)The members of the French Club i

What do I put for numbers 1 though 8

What is bias? •an unbiased sample that is a good depiction of the population as a whole •a representative sample of the population •scientific facts backing up

The number of bonds an atom can form generally depends on ?

Zhang, who is z years old, is 5 years younger than Robert. The sum of their ages is 39. What are their ages?Write an equation. Solve.

What is the slope of the line that passes through the points (8, -4)(8,−4) and (6, 2) ?(6,2)?

The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'

Communication apprehension is the level of fear or anxiety associated with either real or anticipated communication with another person or persons. True False