HappyAstro HappyAstro

01-12-2020
Mathematics

contestada

who ever gets this correct ill give brainliest and thank you and 5 stars

who ever gets this correct ill give brainliest and thank you and 5 stars class=

Respuesta :

collinspuckett collinspuckett

01-12-2020

1 -15
2 27
3 2010
4 -38
5 376
6 -200
7 -3
8 150
9 41
10 -240
11 120
12 -60
13 1
14 9
15 23
16 107
17 45
18 19
19 0
20 4
21 12
22 0

Answer Link

Otras preguntas

Quinn is determining the area of a trapezoid. His work is shown below. mc012-1.jpg Step 1: Break the figure into rectangles and triangles. mc012-2.jpg Step

PLEASE HELP ASAP A diagonal length of a rhombus is multiplied by 2/3. Which of the following describes the effect of this change on the area?

Which is a responsibility of congress? a. determine the constitutionality of laws. b. provide budgets and fund government operations. c. select a new

Two sides of a triangle have the following measure of 7,8.what is the range of possiable values for the 3rd side?

What would be the △Y and the △X for the line that passes through the points (–5, 4) and (2, –2)

A hat contains three ping-pong balls numbered 1, 2, and 3. kim draws one from the hat. then, without replacing the first ball, she draws another. what is the sa

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

Triangle ABC has side lengths: AB = 3.5 cm, BC = 2.4 cm, and AC = 4.2 cm ΔABC ≅ ΔHJK What is the length of side HJ? HJ = ______cm

Help me please im about to give up

Brainliest, what is the total measure of angles 8 and 5 of angle 7 equals 61