emmiefarrimond emmiefarrimond
  • 03-11-2020
  • Mathematics
contestada

What is the nth term rule to -4 -1 2

Respuesta :

kellysnowden665
kellysnowden665 kellysnowden665
  • 03-11-2020

Answer:

-8

Step-by-step explanation:

Answer Link

Otras preguntas

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
A book with 30 pages has 21 pages with printing, 5 pages with printing and pictures, and 4 pages that are blank. What is the theoretical probability of opening
What does the word "Islam" mean?
if f(x)=4x-6, what is f(6)
which goal stated in the preamble to the u.s. constitution requires a strong army
PLEASE!!!!!!!!!! HELP NEEDED QUICKA state offers two lottery games, WinOne and PlayBall. Both games cost $2 per ticket. -In WinOne, the player picks a single
Towards the end of Anne's diary, her entries stop being about her relationship with Peter and focuses more on what? the burglaries in the house the food
How did immigration affect immigrants and other americans in the 1900s?
How would you say good-bye to a friend whom you might not see for a long time? a. Hasta luego. b. Hasta pronto. c. Hasta ahora. d. ¡Adiós! e. Hasta mañana.
a sample of dna contains 20 percent adenine and 30 percent cytosine. What percentage of tymine would you expect to find.