kaitlyn112005 kaitlyn112005
  • 02-11-2020
  • History
contestada

Is the Bronx a city

Respuesta :

bryan4sky
bryan4sky bryan4sky
  • 02-11-2020

Answer:

No, Bronx is a country in New York.

Hope this helps

Sky

Answer Link
cpark2 cpark2
  • 02-11-2020
Bronx is a borough of New york city, coextensive with Bronk County
Answer Link

Otras preguntas

Tin has ___ valence electronics, and chlorine has ___ valence electrons.
Chris sold 5.5 pounds of trail mix. He sold it for $3.98 per pound. How much money did he collect?
Complete the table to determine the amount of money that gabriella would recieve in exchange for 200 u.s dollars in each country
At a party 3/4 cup of dip is left. You divide the 3/4 by 4/5 and divide that between 2 friends
1. in Spanish, what are the two unaccented vowels that can be combined with another vowel to create a diphhong?​
solve the following inequality 2x + 1 < 5
What is the oxidation state of each element in K2Cr207?
The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
Compressing a file is also called _____ the file.
how much hydrogen peroxide to induce vomiting in dogs?