sergio9000 sergio9000

12-10-2020
Biology

contestada

Translate the following DNA sequence:
ATGCCATGGCATTGA

Respuesta :

chefchinoba2020 chefchinoba2020

12-10-2020

The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’
(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)

Answer Link

Otras preguntas

The client empowerment model is effective when

Can you please tell me what this mean i almost cried Turn back the heart you've turned away Give back your kissing breath Leave not my love as you have left The

Graph the line. y=-3+2

Following the birth of Israel, why was it important that Jerusalem was placed under UN supervision? A. both jews & arabs considered it to be independent B

hree different stocks were ordered. The purchase prices were 8 ⅜ dollars, 12 ⅛ dollars and 15 ⅜ dollars.how much was paid for all three stocks?

What could two atoms of the same element form?

Which of the following characteristics are MOST likely to be true of agribusiness? The percentage of the workforce involved in agricultural activities is h

PLEASE HELP! I'LL A MEDAL! List different types of evidence that support evolution. Briefly summarize one type and how this piece of evidence could be refuted.

Given right triangle SIP such that i=54 and s=19, which of the following statements are true? Round to the nearest hundredth. Check all that apply.

Fraction 2 over 3y = Fraction 1 over 4. y = ___?