delilahvera delilahvera

02-10-2020
History

contestada

Why is the first person narrative of an enslaved person so valuable to us?

Respuesta :

elijah4669 elijah4669

02-10-2020

It shows the slaves person point of view, telling you what happensto the slaves all the time.If you were not to have this point of view, people possibly think slavery is good, unlike to what happend to the slaves.They were abuesed in alot of ways

Answer Link

Otras preguntas

The length of a rectangle is 4 times its width and the perimeter is 150 feet. What is the width of the rectangle? A. 75 feet B. 30 feet C. 15 feet D. 60 fe

A student government organization is selling Christmas trees as a fundraiser. On Friday, they sold 5 noble fir trees and 3 douglas fir trees for a total of $420

what is 15/24 in simplest form

a antonym for biosphere

The Earth has four main seasons: winter, spring, summer, and fall. Which of the following is a cause of seasonal changes on Earth? The Earth rotates. The

In a standard dictionary, where can you find the key to pronunciation marks? A. In an appendix B. In the front of the dictionary C. At the bottom of each page D

what is the most common type of vegetation throughout Latin America

The type and age of rocks found in the mountain range are also found on another continent. What might this mean?

There are 23 tables in the library. Each table has 4 chairs. Third grader fill the chairs at 3 tables. Fourth graders fill the chairs at 6 tables. The rest of t

what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5