breebear49 breebear49

14-05-2020
English

contestada

who is smarter in this equation? jj or john b?

Respuesta :

Аноним Аноним

14-05-2020

Answer:

john b

Explanation:

Answer Link

whitenado16 whitenado16

14-05-2020

Answer: jj

Explanation: because who would name there kid john.

jk john a great name!!!!!

Answer Link

Otras preguntas

The textbook defines _____ as a cluster of characteristics that are associated with all members of a specific social group, often including qualities that are u

Mrs. Collins is at the table with you and states that the fourth-degree graphs she has seen have four-real zeros. She asks you if it is possible to create a fou

The word biology means the study of _____. plants animals organisms life

what are the zeros of the function? f(x)=+-6x

Marco is building a house. he bought lots of wood to make the frame of the house. he wants right angles for his corners. if he uses a piece of wood that is cut

Name a few important body functions that your nervous system controls on its own without you having to think about it much?

Can someone please help me with numbers 1, a, b, c, 2, a, b, c

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

Sid is packing crushed ice into a cone-shaped cup. The cone has a height of 5 in. Its base has a diameter of 4 in. What is the volume of the cone?

You must have your insurance ID card with you every time you drive in Florida. A. True B. False