orianarios18
orianarios18 orianarios18
  • 14-04-2020
  • English
contestada

Which tax system places a higher tax rate on wealthier individuals?


flat tax


regressive tax


progressive tax


sales tax

Respuesta :

dagamerperson
dagamerperson dagamerperson
  • 14-04-2020

Answer: progressive tax

Answer Link
k23soccer
k23soccer k23soccer
  • 14-04-2020
it’s progressive tax
hope this helps
Answer Link

Otras preguntas

difference between syntax and semantics
A deck of cards is shuffled and three cards are delt. find the chance the second card is spade and the third card is heart
please help me if you can, thank you!
How would you describe neville chamberlain's policy toward hitler in the late 1930?
Which of the following is a monomial A. 12c B. C^2 -16 C. c^2+c+6 D. C^3 +4c^2 -12c + 7
Which of the following explains why an actual cost might differ from a projected cost? -The desired item goes on sale. -The item is no longer available and a re
How many meters are there in 21 feet?
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
Satellite can focus on specific latitudes using?
How is the creation of public policy in Russia different from that in the United States?