smellycat2202 smellycat2202

14-04-2020
Mathematics

contestada

Find the value of x in the isosceles triangle shown below.

Please answer quick

Find the value of x in the isosceles triangle shown below Please answer quick class=

Respuesta :

CHERLYNnotCHERRY CHERLYNnotCHERRY

14-04-2020

Answer:

The answer is D.

Step-by-step explanation:

Using Pythogaras' Theorem to find the value of x. The formula is, hypo.² = side² + side² :

side = 8 units

side = 12 ÷ 2

= 6 units

hypo.² = 8² + 6²

= 100

hypo. = √100

= 10

Answer Link

Otras preguntas

Make w the subject of Y-aw=2w-1

what is the most important factor that holds a gene pool of a species together and prevents speciation?

What is the slope of the line that contains the points (10,-3) and (8,-9)?

Really need some helpUse the diagram below. Write AD/AB in simplest form.

What happens when energy is changed from one form to another? a. a physical change to a substance occurs. b. all of the energy can be accounted for. c. all of t

^5sqrt4x^2 ^5sqrt4^2

stuck i need help please

Given the parent function of f(x) = x4, what change will occur when the function is changed to f, bracket one half x end bracket? A. Graph opens the same way an

What advice would you give someone whose life dream is to become a judge?

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat