gabriellizarraga68
gabriellizarraga68 gabriellizarraga68
  • 03-03-2020
  • Biology
contestada

How does growing beans in a ziplock bag is faster than in a cup with soil ?

Respuesta :

philaeagles14
philaeagles14 philaeagles14
  • 03-03-2020

Answer: We kept our growing beans in a bag for about two weeks. By then a few of the bean plants grew so tall they started pushing up against the plastic baggie! After two weeks we pulled the paper towel out of the baggie to get a better look at the root systems and the growing stems.

Explanation:

Answer Link
rgkmicro
rgkmicro rgkmicro
  • 09-11-2020

Answer:

sorry can i just answer this for points? thanks ;)

Explanation:

Answer Link

Otras preguntas

what is best android apps​
If VX – 11 = 8, what is the value of x?
If a producer expected the price of a product to go up ,why would they withhold some of the supply ?Plz Help Me l need ?
According to the article who is in the best position to determine which rights and liberties are important. A) the individual
What is the complementary DNA strand for the DNA strand AATTGGCCATGCATGATTACGA
Help Me! I don't understand this problem!
plsss help asap it would meannn alotttt plss and tyyy
Engineers for The All-Terrain Bike Company have determined that a 15% increase in all inputs will cause a 15% increase in output. Assuming that input prices rem
Read the poem "Nothing Gold Can Stay" by Robert Frost. Nature's first green is gold, Her hardest hue to hold. Her early leaf's a flower; But only so an hour. Th
A plan traveled 324 miles each way to Austin and back. The trip there was with the wind. It took 3 hours. The trip back was into the wind. The trip took 6 hours