michelleruiz723 michelleruiz723
  • 03-12-2019
  • History
contestada

what was the downfall of mesopotamia

Respuesta :

s9152707 s9152707
  • 03-12-2019

Answer:

Scientists believe that Mashkan-shapir's collapse was caused in part by destruction of the fields by mineral salts. When mineral salts concentrate in the upper levels of the soil, it becomes poisonous for plants. In Mesopotamia, irrigation was essential for crop production.\

Answer Link

Otras preguntas

If o- can give to every other blood type, why cant it recieve other blood types
If abcd is a trapezoid with bases ab and dc. if ab=20, bc = 30, cd = 48, and ad =26, find the height of the trapezoid
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
For how many different values of θ between 0 and 2π radians is sec x = csc x ?
A circular swimming pool has a diameter of 12 feet. What is the circumference the pool? Use 3.14 to approximate for π . Enter your answer, as a decimal rou
zimmerman note definition
in 1990, there were 350 cell phone subscribers in the small town of Centerville. The number of subscribers increased by 35% per year after 1990
7. A company's marginal revenue is $10, its marginal cost is $10, and its price is $10. This company is operating in a/an _______ market structure. A
Less developed countries (LDCs) have a/an____ population growth. A.average B. negative C. positive D. unchanged
all other things being equal,the size of a population will decrease if