rubyfox389
rubyfox389 rubyfox389
  • 03-10-2019
  • Arts
contestada

How do art critics interpret art?

Respuesta :

emmora
emmora emmora
  • 04-10-2019

Answer:

Art criticism is responding to, interpreting meaning, and making critical judgments about specific works of art. Art critics help viewers perceive, interpret, and judge artworks. Critics tend to focus more on modern and contemporary art from cultures close to their own.

Answer Link
noelanietaveras69
noelanietaveras69 noelanietaveras69
  • 15-02-2021

They see if they like the art or not? I don't know,  i´m just bored lol

Answer Link

Otras preguntas

You are part of the response to a motor vehicle collision on a busy highway. There are multiple vehicles involved and multiple casualties. The police and local
What are the six steps of polcy advocates
Nepal is in the Himalaya Mountains?
What is the complementary DNA strand for the DNA strand AATTGGCCATGCATGATTACGA
If x=2 and y=4 what is the answer to 3x + 2y + 4
A 1 phase load operates at 600 V and consumes 75 kW with a 0.85 lagging power factor. Compute the complex power consumed by the load. Type the answer with two d
Which situation is an example of a citizen participating in the political process? citizen attends a public schod O B. A citizen serves in the military. O C. A
Simplify (write without the absolute value sign): 120+x, if x <- 120
How many themes are there in the Edexcel GCSE business studies exam
A survey of 480 high school students found that 37% had a pet. Find the margin of error. Round to the nearest percent. Use the margin of error to find an interv