elizam170 elizam170
  • 03-09-2019
  • Mathematics
contestada

Is the area always bigger than the perimeter

Respuesta :

sharonramirez443
sharonramirez443 sharonramirez443
  • 03-09-2019

There are different units for perimeter and area The perimeter has the same units as the length of the sides of rectangle or square whereas the area's unit is squared.

Answer Link

Otras preguntas

The rectangle has an area of 4(x+3) square units. A- If the dimensions of the rectangle are doubled, what is the area of the new rectangle in terms of x? Show y
a summary about concussions
Which is one type of play that Shakespeare wrote? A. histories B. musicals C. passion plays D. burlesques Question Resources
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Emma uses a 250 meter roll of crepe paper to make streamers. How many dekameters of creme paper does emma use?
Why did the french revolution happen and who's fault was it
Divide the polynomial in the numerator by the trinomial in the denominator m^3-m^2-4m+1 /m^2+2m-3
how to i do 7/16÷(31/2÷1/2)
Which sentence does not contain any errors in comma usage? A. If you ever visit New Haven, Connecticut, be sure to eat at Sally's Pizza. B. The original Londo
Which sentence has two antecedents and one pronoun? Laurie likes to bake in her new oven. Cody and Aleena sold their car. My school does not have an October