jappa123 jappa123
  • 01-08-2019
  • Mathematics
contestada

HURRY I NEED HELP!!! Solve triangle JKL round to the answer to the nearest tenth

HURRY I NEED HELP Solve triangle JKL round to the answer to the nearest tenth class=

Respuesta :

Аноним Аноним
  • 01-08-2019

Answer:

It's Option A.

Step-by-step explanation:

Using the Cosine Rule:

cos < K =  (3.9^2 - 1.9^2 - 2.8^2) / (-2 *1.9*2.8)

=  3.76 / -10.64

= - 0.3534.

m < K = 110.7 degrees.

Using the Sine Rule:

3.9 / sin 110.7 = 2.8 / sin <J

sin J =   2.8 sin 110.7/ 3.9 = 0.6716

m < J = 42.2 degrees

So m < L = 180 - (110.7 + 42.2)

= 180 - 152.9

= 27.1 degrees

Answer Link

Otras preguntas

The _______ was Franklin Roosevelt's program designed to fight the Great Depression
Use factoring to simplify the expression x^2-x-6/x-3 assume that x does not equal 3
When a red blood cell is placed in hypertonic (very concentrated) solutions of nacl?
What distinguished the bantu religion from buddhism, christianity, and islam?
When did the eastern part of the Roman Empire fall?
Using the point-slope equation, find the equation containing (-2, -4) and slope m = -1
Frederick douglass' ability to read and write furthered the ______________ movement that ultimately put an end to ________________ in the u.s.
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
which statement about nuclear fusion is correctA) Two hydrogen electrons become protons during fusion B) Helium nuclei xan fuse to form electrons such as nitrog
which of the following harvesting methods is used in large farmhouses a)sickle b)oxen trampling c)combine d)thresher