mackayla178
mackayla178 mackayla178
  • 03-05-2019
  • Mathematics
contestada

help, please?
I can't figure it out and I need the answer quick.

help please I cant figure it out and I need the answer quick class=

Respuesta :

wegnerkolmp2741o
wegnerkolmp2741o wegnerkolmp2741o
  • 04-05-2019

Answer:

f(x) ^-1 = 1/5 x

Step-by-step explanation:

f(x) = 5x

y =5x

To find the inverse, exchange x and y and solve for y

x =5y

Divide each side by 5

1/5x = 5y/5

1/5 x = y

1/5 x = f(x) ^-1

f(x) ^-1 = 1/5 x

Answer Link

Otras preguntas

The sum of three numbers is 84 the second number is 2 times the third the first number is 8 more than the third what are the numbers
how would u form a superlative for the adverb widely
Which is the best description of the events of A Midsummer Night's Dream? A. logical and tragic B. serious and historically accurate C. comical and fantasy-l
Which sentence does not contain any errors in comma usage? A. If you ever visit New Haven, Connecticut, be sure to eat at Sally's Pizza. B. The original Londo
why is it critical to your cells to be near capillaries
the bombing of Hiroshima and Nagasaki resulted in
What property is shown by the equation? 1. 0 ÷ (–6) = 0
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
In which sentence does the prepositional phrase act as an adverb? A. Last evening, Anne suffered from a headache. B. The door to the attic was left open. C. Mr
A student government organization is selling Christmas trees as a fundraiser. On Friday, they sold 5 noble fir trees and 3 douglas fir trees for a total of $420