andreweggert99
andreweggert99 andreweggert99
  • 01-04-2016
  • Mathematics
contestada

Convert 57ft per hour to 57 ft per minute. How do I convert from ft per hr to ft per min?

Respuesta :

penfila11Pen
penfila11Pen penfila11Pen
  • 01-04-2016
Divide by 60 because it is hour to minutes. Just ignore the feet because it can confuse you. Since it is the same unit before and after the conversion, we dont have to do anything to it.
57 ft/hr⇒ 57 ft/min
ft and ft cancel
divide 60(hour to minutes)
[tex] \frac{57}{60} [/tex]
Answer is 0.95 ft/min
Answer Link

Otras preguntas

how do i find the angles on a kite?
On a map, the distance between two cities is 7.3 centimeters. The map scale is 1 cm:50 km. What is the actual distance between the two cities?
Please help me with this two step math problem! THANK YOU !!!!!!!!
one-third of the fish in Liam's fish tank were added today. Half of the other fish were a gift to Liam last week. the other 9 came from Liam's old fish tank.
How many combinations of 5 students can a teacher choose from 24 students? A. 5,100,480 B. 42,504 C. 7,962,624 D. 120
i need help with #3
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Which is an example of a structural adaptation of a plant? A. plant moving toward light to increase photosynthesis B. roots responding to gravity to get to wa
Which is one type of play that Shakespeare wrote? A. histories B. musicals C. passion plays D. burlesques Question Resources
Why did we use coin-flipping as a method to choose traits for the parent pets and the offspring pets?