cielo9872 cielo9872

03-10-2018
Mathematics

contestada

Tim counts his friends fingers by fives.He counts six hands.What numbers does he say?

Respuesta :

isabellamkop isabellamkop

03-10-2018

30
5;10;15;20;25;30
I hope I helped you

Answer Link

Otras preguntas

Kalina is choosing a sandwich and a drink for lunch. She can choose between turkey, ham, and vegetarian sandwiches. She chooses her drink from a selection of wa

Toco el piano _______________ hace dos meses. desde se les por

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

Boris has scored 80, 93, 63, 83, and 83 on his previous five tests. what score does he need on his next test so that his average (mean) is 79?

What is the solution to the following equation? 5(2x − 14) + 23 = 7x − 14 11 14 30 36

If 100 kg of cucumbers are 99% water, how much do they weigh if they are 97% water?

what is the smallest unit that can evolve

Questions 1–10: Identify each redundant expression. Some sentences contain no redundancies. 1. Weather conditions forced the regional managers to postpone thei

What transportation technology made getting around in cities easier in the mid to late 1800s? A. Automobiles B. Cable cars C. Gondolas D. Horses

It is illegal for a minor to even attempt to purchase alcohol. a. True b. False